KEGG   Azotobacter chroococcum: Achr_b100
Entry
Achr_b100         ncRNA     T03640                                 

Name
(GenBank) traJ-II RNA
Organism
acx  Azotobacter chroococcum
SSDB
LinkDB
Position
pAcX50b:11809..11909
NT seq 101 nt   +upstreamnt  +downstreamnt
gcggggaaagcgcggcctcacctccagggggccaccccaccgggctaggccggccccacc
accctcggccgccaatttcccctgccagggtctgtcgccac

DBGET integrated database retrieval system