KEGG   Methylorubrum extorquens CM4: Mchl_3021Help
Entry
Mchl_3021         CDS       T00809                                 

Definition
(GenBank) endo-1,4-beta-glucanase
Organism
mch  Methylorubrum extorquens CM4
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ACK83859
UniProt: B7KRC3
LinkDB All DBs
Position
3191506..3192009
Genome map
AA seq 167 aa AA seqDB search
MTKMRTVWVGLLASGAGLVAMPAVAQTSGGAGLPSGFTAPGLPFGPTSSVATVAAPSPTM
ALANPGGLSFGGASRASGLGASTPSGSNAGGLSFGGAASTAVGGSGLRSTGGGAGALGRR
PLDDVAANPGSGGGGGAPAGAGIAGGGGFSRRPTDAYFDPLSGSGLR
NT seq 504 nt NT seq  +upstreamnt  +downstreamnt
atgaccaagatgcgcaccgtgtgggtcggcctcctggcctcgggcgctgggctggtcgcc
atgccggctgttgcccagacatccggcggcgctggattgccctccggcttcaccgcgccc
ggccttcccttcggtccgacgtcgtcggttgcgacggtggcggcgccgagtccgaccatg
gcgcttgccaatcccggcggattgagtttcggcggcgcctcccgtgcgtcgggcctcggc
gcatccacaccgtccggcagcaatgccggaggtttgagcttcggcggcgcggcctcgacc
gccgtcggcggctccggactgcgttcgaccggcggcggggcgggagctctcggacgccgc
cccctcgacgacgtggccgccaatcccggatcgggcgggggagggggtgcgcccgcgggt
gccggcatcgccggtggcggaggcttctcccgcagaccgaccgatgcttacttcgacccg
ctctccggctccggcctgcgctga

DBGET integrated database retrieval system