Streptomyces bathyalis: G4Z16_26660 Help Entry G4Z16_26660       CDS       T07305                                  Name (GenBank) chorismate mutase   KO K04092   chorismate mutase [EC:5.4.99.5] Organism sbat  Streptomyces bathyalis Pathway sbat00400   Phenylalanine, tyrosine and tryptophan biosynthesis sbat01100   Metabolic pathways sbat01110   Biosynthesis of secondary metabolites sbat01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:sbat00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     G4Z16_26660 Enzymes [BR:sbat01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      G4Z16_26660 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 Motif Other DBs NCBI-ProteinID:  QPP11025 UniProt:  A0A7T1TDN1 LinkDB All DBs Position 6164104..6164382 Genome browser AA seq 92 aa AA seqDB search MRAELIELRDSIDNIDAAVVHMLAERFKCTQRVGRLKADHDLPPADPAREARQIARLREL AVSAKLDPAFAEKLLNFVIAEVIRHHETIARA NT seq 279 nt NT seq  +upstreamnt  +downstreamnt gtgcgcgccgagctgatcgagctgcgcgacagcatcgacaacatcgacgcggcggtggtg cacatgctcgcggagcgcttcaaatgcacacagcgcgtcggccgcctcaaggccgaccac gatctgccccccgccgatcccgcccgcgaggccaggcagatcgcgcggctgagggagctt gccgtctcggcgaagctcgacccggcgttcgcggagaagctgctcaacttcgtcatcgcc gaggtgatccgccaccacgagacgatcgcccgcgcctga

DBGET integrated database retrieval system