Streptomyces broussonetiae: GQF42_26495 Help Entry GQF42_26495       CDS       T07359                                  Name (GenBank) chorismate mutase   KO K04093   chorismate mutase [EC:5.4.99.5] Organism sbro  Streptomyces broussonetiae Pathway sbro00400   Phenylalanine, tyrosine and tryptophan biosynthesis sbro01100   Metabolic pathways sbro01110   Biosynthesis of secondary metabolites sbro01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:sbro00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     GQF42_26495 Enzymes [BR:sbro01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      GQF42_26495 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 DUF977 Motif Other DBs NCBI-ProteinID:  QHA06359 UniProt:  A0A6I6N6P5 LinkDB All DBs Position complement(5704268..5704525) Genome browser AA seq 85 aa AA seqDB search MTTTSPEATIADARERIDALDDRIIGLIQERMAVSDVVQQTRIASGGRRVSLSREMEILG RYREALGKPGTTLAMTLLELCRGRI NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgaccaccacctccccggaagcgaccatcgccgacgcccgtgagcggatcgacgcgctc gacgaccggatcatcggcctcatccaggagcggatggccgtctccgacgtcgtccagcag acccgtatcgcctccggcggccggcgggtcagcctctcgcgcgagatggagatcctcggc cgctaccgcgaggccctcggcaagcccggcaccaccctcgcgatgaccctgctcgagctg tgccggggccgcatctga

DBGET integrated database retrieval system