Streptomyces cyanogenus: S1361_23875 Help Entry S1361_23875       CDS       T07416                                  Name (GenBank) Intracellular chorismate mutase   KO K04093   chorismate mutase [EC:5.4.99.5] Organism scyg  Streptomyces cyanogenus Pathway scyg00400   Phenylalanine, tyrosine and tryptophan biosynthesis scyg01100   Metabolic pathways scyg01110   Biosynthesis of secondary metabolites scyg01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:scyg00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     S1361_23875 Enzymes [BR:scyg01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      S1361_23875 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 DUF977 Motif Other DBs NCBI-ProteinID:  QTE00391 LinkDB All DBs Position complement(5285806..5286081) Genome browser AA seq 91 aa AA seqDB search MTTTSPEAAAGPETIIADARERIDALDDRIIGLVQERMAVSAVVQQTRIASGGRRVHLSR EMEILARYRDALGKPGTSLAMTLLELSRGRI NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgaccaccaccagcccggaagcggccgccggcccggagacgatcatcgccgacgcccgt gagcgcatcgacgcgctcgacgaccggatcatcggcctcgtccaggagcggatggccgtc tccgccgtcgtccagcagacccggatcgcctccggcggccggcgggtgcacctctcccgc gagatggagatcctcgcccgctaccgggacgccctcggcaagcccggcaccagcctcgcc atgactctgctggagctgagccggggtcgtatctga

DBGET integrated database retrieval system