Streptococcus gwangjuense: D7D53_00865 Help Entry D7D53_00865       CDS       T06667                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism sgw  Streptococcus gwangjuense Pathway sgw01100   Metabolic pathways sgw01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:sgw00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     D7D53_00865   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     D7D53_00865 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AYF95131 UniProt:  A0A387B0C6 LinkDB All DBs Position 198123..198347 Genome browser AA seq 74 aa AA seqDB search MAVFEKVQEIIVEELGKDASEVTLESTFDDLDADSLDLFQVISEIEDAFDIQIEAEDDLK TVGDLVAYVEEQTK NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atggcagtatttgaaaaagtacaagaaattatcgttgaagaacttggaaaagacgcatca gaagtaacacttgaatcaacttttgatgatttggacgcagattcattggacttgttccaa gtaatctcagaaatcgaagatgcttttgatatccaaatcgaagcagaagatgacttgaaa acagttggtgacttggttgcctacgttgaagagcaaacaaaataa

DBGET integrated database retrieval system