Streptomyces roseirectus: IAG44_15490 Help Entry IAG44_15490       CDS       T07860                                  Name (GenBank) chorismate mutase   KO K04093   chorismate mutase [EC:5.4.99.5] Organism sroi  Streptomyces roseirectus Pathway sroi00400   Phenylalanine, tyrosine and tryptophan biosynthesis sroi01100   Metabolic pathways sroi01110   Biosynthesis of secondary metabolites sroi01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:sroi00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     IAG44_15490 Enzymes [BR:sroi01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      IAG44_15490 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 Motif Other DBs NCBI-ProteinID:  QNP70695 UniProt:  A0A7H0ID29 LinkDB All DBs Position 3731734..3732015 Genome browser AA seq 93 aa AA seqDB search MTALDITGAKTAEAADVITGARERIDALDDRIIGLIQERVAVSAVVQDARIASGGRRVNL SREMEILAHYSEALGKPGTALAMTLLELCRGRI NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atgaccgccctcgacatcaccggcgcgaagaccgccgaggccgccgacgtcatcaccggc gcgcgcgagcgcatcgacgccctcgacgaccgcatcatcggcctgatccaggaacgcgtc gccgtctccgccgtcgtccaggacgcccgtatcgcctccggcggccggcgcgtgaacctc tcccgcgagatggagatcctggcccactacagcgaggcgctgggcaagccggggacggcg ctggcgatgacgttgctcgaactgtgccggggccggatctga

DBGET integrated database retrieval system