Streptomyces seoulensis: D0Z67_17610 Help Entry D0Z67_17610       CDS       T07029                                  Name (GenBank) chorismate mutase   KO K04093   chorismate mutase [EC:5.4.99.5] Organism sseo  Streptomyces seoulensis Pathway sseo00400   Phenylalanine, tyrosine and tryptophan biosynthesis sseo01100   Metabolic pathways sseo01110   Biosynthesis of secondary metabolites sseo01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:sseo00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     D0Z67_17610 Enzymes [BR:sseo01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      D0Z67_17610 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 DUF977 TPR_MLP1_2 Motif Other DBs NCBI-ProteinID:  QBJ91923 UniProt:  A0A4P6TYK6 LinkDB All DBs Position complement(3754178..3754447) Genome browser AA seq 89 aa AA seqDB search MTTATSHTEPERTIDDARTQIDALDDRIIGLVQERMAVSAVVQQTRIATGGRRVSLSREM EILGRYRDALGKPGTALAMTLLELCRGRI NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgaccaccgccacctcgcacaccgagcccgagcggaccatcgacgacgcccggacgcaa atcgacgccctcgacgaccggatcatcggcctcgtccaggagcggatggccgtctccgcc gtcgtccagcagacccggatcgccaccggcggccgccgggtgagcctgtcccgcgagatg gagatcctcggccgctaccgggacgccctcggcaagccgggcaccgcgctcgccatgacc ctgctggagctgtgccggggtcgcatctga

DBGET integrated database retrieval system