Streptomyces subrutilus: CP968_13600 Help Entry CP968_13600       CDS       T07087                                  Name (GenBank) chorismate mutase   KO K04093   chorismate mutase [EC:5.4.99.5] Organism ssub  Streptomyces subrutilus Pathway ssub00400   Phenylalanine, tyrosine and tryptophan biosynthesis ssub01100   Metabolic pathways ssub01110   Biosynthesis of secondary metabolites ssub01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:ssub00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     CP968_13600 Enzymes [BR:ssub01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      CP968_13600 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 Motif Other DBs NCBI-ProteinID:  QEU79211 UniProt:  A0A5P2UNL4 LinkDB All DBs Position 3149104..3149364 Genome browser AA seq 86 aa AA seqDB search MTTTTTPEQLIADSRTRIDALDDRIIGLIQERMAVSTVIQEARISSGGRRVHLSREMEVL SHWSGALGKPGTTLALTLLELCRGRV NT seq 261 nt NT seq  +upstreamnt  +downstreamnt gtgaccacgaccaccacccccgagcagctcatcgccgactcccgcacccgcatcgacgcc ctcgacgaccggatcatcggtctgatccaggagcggatggccgtctccaccgtcatccag gaggcgcggatctcctccggcgggcgccgggtgcacctgtcccgcgagatggaggtgctc tcgcattggagcggtgccctcggaaagcccggcaccacactggccctgaccctgctggag ctgtgccggggccgcgtctga

DBGET integrated database retrieval system