Takifugu rubripes (torafugu): 102464246 Help Entry 102464246         miRNA     T02386                                  Symbol mir21 Name (RefSeq) fru-miR-21   KO K16863   microRNA 21 Organism tru  Takifugu rubripes (torafugu) Brite KEGG Orthology (KO) [BR:tru00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tru04147]     102464246 (mir21)   09184 RNA family    03100 Non-coding RNAs [BR:tru03100]     102464246 (mir21) Exosome [BR:tru04147]  Exosomal RNA   Exosomal RNA of breast milk    102464246 (mir21)   Exosomal RNA of ovarian cancer cells    102464246 (mir21)   Exosomal RNA of lung cancer cells    102464246 (mir21)   Exosomal RNA of other cancer cells    102464246 (mir21) Non-coding RNAs [BR:tru03100]  Small non-coding RNA   Micro RNA    102464246 (mir21) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  102464246 Ensembl:  ENSTRUG00000019151 miRBase:  MI0003325 LinkDB All DBs Position 15:3285153..3285225 Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt tagcttatcagactggtgttggc

DBGET integrated database retrieval system