Acetobacter aceti: A0U92_07880 Help Entry A0U92_07880       CDS       T04735                                  Name (GenBank) glutaredoxin   KO K03676   glutaredoxin 3 Organism aace  Acetobacter aceti Brite KEGG Orthology (KO) [BR:aace00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:aace03110]     A0U92_07880 Chaperones and folding catalysts [BR:aace03110]  Protein folding catalysts   Protein disulfide isomerase    A0U92_07880 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_3 GST_N_2 Glrx-like Thioredoxin_3 SH3BGR Motif Other DBs NCBI-ProteinID:  AQS84706 UniProt:  A0A1U9KG07 LinkDB All DBs Position 1760415..1760675 Genome browser AA seq 86 aa AA seqDB search MPKIEIYTQPGCPYCVRAVALLDHKKASFTEINAPHGTQERVDARERSGGRTTVPQIFVD GRAIGGCDDLFALERSGKLDALLQAA NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atgccgaagatcgagatctacacacagccgggttgcccttactgcgttcgggctgtggcg ctccttgaccataaaaaagcgtctttcacggagatcaacgcgccacacggcacacaggaa cgtgtggatgcgcgggagcgttccggcggcaggaccacggttccgcagatttttgtggat ggcagggccatcggtggctgtgacgatctctttgcgcttgagcggagcggaaagctggac gccctgctgcaggccgcctga

DBGET integrated database retrieval system