Suicoccus acidiformans: CL176_05015 Help Entry CL176_05015       CDS       T05652                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism abae  Suicoccus acidiformans Pathway abae01100   Metabolic pathways abae01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:abae00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     CL176_05015 (acpP)    00074 Mycolic acid biosynthesis     CL176_05015 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     CL176_05015 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C Ribosomal_L12_N PP-binding_2 Rad60-SLD Tudor_3 Motif Other DBs NCBI-ProteinID:  AXY25412 UniProt:  A0A347WK05 LinkDB All DBs Position 1064574..1064810 Genome browser AA seq 78 aa AA seqDB search MAEESTFVEVQHMIVERFGVQESVVTPEMTFDDLGADSLDVVELVMEIEDKYNIQFDDEK IEELQTIGDAVSYIEELK NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggcagaagagtcaacatttgttgaagtgcaacatatgattgtggagcgcttcggtgtt caagaatcggttgtcacaccagagatgacctttgatgatttaggagcagattcattggat gtagttgaacttgttatggagattgaggacaagtacaatattcaatttgatgatgagaag attgaagagctgcagacaattggggatgccgtttcttatattgaggaattaaaataa

DBGET integrated database retrieval system