Actinacidiphila bryophytorum: NYE86_15460 Help Entry NYE86_15460       CDS       T08584                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism abry  Actinacidiphila bryophytorum Pathway abry00253   Tetracycline biosynthesis abry01056   Biosynthesis of type II polyketide backbone abry01100   Metabolic pathways abry01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:abry00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     NYE86_15460    00253 Tetracycline biosynthesis     NYE86_15460  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:abry01004]     NYE86_15460    01008 Polyketide biosynthesis proteins [BR:abry01008]     NYE86_15460 Lipid biosynthesis proteins [BR:abry01004]  Polyketide synthase   Component type    NYE86_15460 Polyketide biosynthesis proteins [BR:abry01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      NYE86_15460     Nonaketide PKS      NYE86_15460     Decaketide PKS      NYE86_15460 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  UWE09968 LinkDB All DBs Position complement(3609756..3610025) Genome browser AA seq 89 aa AA seqDB search MPGTAFTLEALKRILLEGAGASEDVDLDGDILDTDFEALGYESLALLETGGRIEREFGIA LDDSALTVARTPRALIDVVNAHLSSTPAV NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgcccggcaccgcattcaccctggaggcgctcaaaaggatcctgctggagggcgcaggc gccagcgaggacgtcgacctcgacggcgacatcctcgacaccgacttcgaggccctgggc tacgagtcgctggccctgctggagaccggcgggcgtatcgagcgggagttcggcatcgcg ctcgacgactccgcgctcaccgtggcccgcacgccccgcgcgctgatcgacgtggtcaac gcgcacctgtccagcacgccggccgtctga

DBGET integrated database retrieval system