Actinomyces capricornis: MANAM107_25930 Help Entry MANAM107_25930    CDS       T09393                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism acap  Actinomyces capricornis Pathway acap01100   Metabolic pathways acap01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:acap00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     MANAM107_25930 (acpP)    00074 Mycolic acid biosynthesis     MANAM107_25930 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     MANAM107_25930 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF8113 Vg_Tdu Motif Other DBs NCBI-ProteinID:  BDA65759 UniProt:  A0ABN6K7X9 LinkDB All DBs Position 3154119..3154364 Genome browser AA seq 81 aa AA seqDB search MTQSTEVLETITRIVAEEAGVEASSITRDSRFAQDLDIDSLGLLTIATQVEEHFSVALDD SLIPTLPTVGSLVDLVTAQQA NT seq 246 nt NT seq  +upstreamnt  +downstreamnt atgacccagagcaccgaggtccttgagaccatcacccggatcgtcgccgaggaggccggg gtggaggcgtcctccatcacccgggacagccgcttcgcccaggacctggacatcgactcc ctggggctgctgaccatcgccacgcaggtggaggagcacttctccgtcgccctggacgac tccctcatccccaccctgcccaccgtgggctccctggtggacctggtcaccgcgcagcag gcctga

DBGET integrated database retrieval system