Acinetobacter sp. Ac-14: IOD65_13120 Help Entry IOD65_13120       CDS       T11083                                  Name (GenBank) phenol hydroxylase   KO K16245   phenol/toluene 2-monooxygenase (NADH) P4/A4 [EC:1.14.13.244 1.14.13.243] Organism acic  Acinetobacter sp. Ac-14 Pathway acic00361   Chlorocyclohexane and chlorobenzene degradation acic00362   Benzoate degradation acic00623   Toluene degradation acic01100   Metabolic pathways acic01120   Microbial metabolism in diverse environments acic01220   Degradation of aromatic compounds Module acic_M00548   Benzene degradation, benzene => catechol Brite KEGG Orthology (KO) [BR:acic00001]  09100 Metabolism   09111 Xenobiotics biodegradation and metabolism    00362 Benzoate degradation     IOD65_13120    00361 Chlorocyclohexane and chlorobenzene degradation     IOD65_13120    00623 Toluene degradation     IOD65_13120 Enzymes [BR:acic01000]  1. Oxidoreductases   1.14  Acting on paired donors, with incorporation or reduction of molecular oxygen    1.14.13  With NADH or NADPH as one donor, and incorporation of one atom of oxygen into the other donor     1.14.13.243  toluene 2-monooxygenase      IOD65_13120     1.14.13.244  phenol 2-monooxygenase (NADH)      IOD65_13120 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-ProteinID:  QOW98093 LinkDB All DBs Position 2743166..2743528 Genome browser AA seq 120 aa AA seqDB search MTVRAIHNNYQFEPLDLQKNYGDQFLLYVGWDHHTLFCSAHAMLASPQQTLGQLIEQQIT GGFAQHPDFAKIDWSKVQYTLDGQTINPENTQSLAELGFGHKSLLRFVTPELNGYNDSYV NT seq 363 nt NT seq  +upstreamnt  +downstreamnt atgactgttcgcgcgatacacaacaattatcaatttgaaccacttgatttgcaaaaaaat tatggcgatcaattcttactttacgtgggttgggatcatcacacacttttttgctcagcg catgccatgcttgcctcacctcaacaaactttgggacagttgattgagcaacaaattaca ggtggttttgcccaacatccagattttgccaaaattgattggtcaaaagtgcaatacact ttagatggtcaaacaatcaatccagagaatacacaaagcttggcagagcttggttttggg cataagtcattgcttcgtttcgttacgccagaattaaatggctataacgacagctacgtt taa

DBGET integrated database retrieval system