Acidocella sp. MX-AZ03: GT370_02720 Help Entry GT370_02720       CDS       T08719                                  Name (GenBank) hypothetical protein   KO K18997   chaperone modulatory protein CbpM Organism acim  Acidocella sp. MX-AZ03 Brite KEGG Orthology (KO) [BR:acim00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:acim03036]     GT370_02720 Chromosome and associated proteins [BR:acim03036]  Prokaryotic type   Nucleoid associated proteins    Other nucleoid associated proteins     GT370_02720 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MerR_2 HAAS DUF4800 Motif Other DBs NCBI-ProteinID:  WBO59824 LinkDB All DBs Position complement(481155..481349) Genome browser AA seq 64 aa AA seqDB search MDVARIRLIQTLRHDLEIGEAAMPVVLSLLDQLYELRRNAAKLNAALASLPPEAREAILD KLNK NT seq 195 nt NT seq  +upstreamnt  +downstreamnt gtggatgtagcgcggatcaggctgatccagacgctgcgccatgatctggagattggcgag gcggcgatgccggtggtgctgtcgctgctggaccagctctacgagttgcggcgcaacgcg gcgaagctgaacgcggcgctggcgagcctgccgccggaggcgcgcgaggcgattctggat aaactaaataaataa

DBGET integrated database retrieval system