Aphelocoma coerulescens (scrub jay): 138116853 Help Entry 138116853         CDS       T10543                                  Name (RefSeq) metallothionein-1   KO K14739   metallothionein 1/2 Organism acoe  Aphelocoma coerulescens (scrub jay) Brite Messenger RNA biogenesis [BR:acoe03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      138116853 Mitochondrial biogenesis [BR:acoe03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     138116853 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  138116853 NCBI-ProteinID:  XP_068882729 LinkDB All DBs Position 11:complement(8440833..8442188) Genome browser AA seq 63 aa AA seqDB search MDSQDCPCATGGTCTCGDNCKCKNCKCTSCKKGCCSCCPAGCAKCAQGCVCKGPPSAKCS CCK NT seq 192 nt NT seq  +upstreamnt  +downstreamnt atggactctcaggattgcccttgtgccacaggtggcacctgcacctgcggggacaactgc aaatgcaaaaactgcaaatgcacatcgtgcaaaaaaggctgctgctcctgctgcccagct ggatgtgccaagtgtgcacagggctgcgtctgcaaggggcctccctctgccaagtgcagc tgctgcaaatag

DBGET integrated database retrieval system