Amycolatopsis coloradensis: LCL61_18025 Help Entry LCL61_18025       CDS       T10308                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism acor  Amycolatopsis coloradensis Pathway acor00998   Biosynthesis of various antibiotics acor01100   Metabolic pathways acor01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:acor00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     LCL61_18025    00074 Mycolic acid biosynthesis     LCL61_18025   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     LCL61_18025 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  WYW17448 LinkDB All DBs Position complement(3757636..3757896) Genome browser AA seq 86 aa AA seqDB search MTSSDDLARVIVSHLSAALGVPAAEIALDAQLTHLENASSLRLLTAVSAVEEELSLELDP DDLVRVRTVADLANLVEGRIRSSEAH NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atgacgtcatccgacgatcttgcacgagtgatagtcagtcacctgtcggccgcgctcggc gtgcccgccgccgagatcgccctcgacgcacagctcacccacctcgagaacgccagctcg ctgcgactgctcaccgcggtctccgctgtcgaggaggaactctccctcgaactggatccc gacgacttggtccgggtacggaccgtcgccgatctggcgaacctggtcgaaggccggatt cgctcttccgaggcgcactga

DBGET integrated database retrieval system