Acinetobacter corruptisaponis: QLH32_15165 Help Entry QLH32_15165       CDS       T10473                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism acot  Acinetobacter corruptisaponis Pathway acot01100   Metabolic pathways acot01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:acot00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QLH32_15165 (acpP)    00074 Mycolic acid biosynthesis     QLH32_15165 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QLH32_15165 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C TerB Ribosomal_L12_N Motif Other DBs NCBI-ProteinID:  WHP05340 UniProt:  A0ABY8S116 LinkDB All DBs Position 3194253..3194495 Genome browser AA seq 80 aa AA seqDB search MDIAKRIKQIIIEQFSVDEQEVKPHATFTEDLGADSLGVVELIMALESEFGIQIPYEAAE KIITVQSAIDYMANIVGENA NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atggatatagcaaaacgtattaaacaaatcatcattgagcaatttagtgtagatgagcag gaggttaagcctcatgcaacttttacagaggatttaggggccgattcattgggggtggtt gaactcattatggctcttgaaagtgagtttggtattcaaattccatatgaagcggcagag aaaattatcacagtccaatccgcaattgattatatggcgaatattgtgggagaaaatgcc taa

DBGET integrated database retrieval system