Anolis carolinensis (green anole): 103280762 Help Entry 103280762         CDS       T01608                                  Symbol cd24 Name (RefSeq) CD24 molecule   KO K06469   CD24 antigen Organism acs  Anolis carolinensis (green anole) Pathway acs04148   Efferocytosis Brite KEGG Orthology (KO) [BR:acs00001]  09140 Cellular Processes   09141 Transport and catabolism    04148 Efferocytosis     103280762 (cd24)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04090 CD molecules [BR:acs04090]     103280762 (cd24)    00537 Glycosylphosphatidylinositol (GPI)-anchored proteins [BR:acs00537]     103280762 (cd24) CD molecules [BR:acs04090]  Proteins   103280762 (cd24) Glycosylphosphatidylinositol (GPI)-anchored proteins [BR:acs00537]  Antigens   103280762 (cd24) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CD24 Motif Other DBs NCBI-GeneID:  103280762 NCBI-ProteinID:  XP_008118963 LinkDB All DBs Position 1:complement(189562481..189570519) Genome browser AA seq 78 aa AA seqDB search MGRALATRLGLGLLLLALLLPTQTGGQNGTTASPHNSTSGVTSVPLSTLNITTTPGHGNS LQSTTGLFILSIFLLYVC NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atgggcagggcgctggcgacgcggctgggcttagggctcctgctcctggcgcttctcctc cccacgcagacaggtggacaaaatggaacaactgcatccccccacaacagtacttccggt gtgacgtctgtgccgcttagcacactgaacattaccacaacaccaggacatggaaactca cttcaatcaactactggcctcttcattctctctatctttcttctctatgtttgttaa

DBGET integrated database retrieval system