KEGG   Azotobacter chroococcum: Achr_35280
Entry
Achr_35280        tRNA      T03640                                 
Name
(GenBank) tRNA-Tyr
  KO
K14236  tRNA Tyr
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_35280
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_35280
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_35280
SSDB
LinkDB
Position
complement(3914682..3914763)
NT seq 82 nt   +upstreamnt  +downstreamnt
ggaggggttcccgagtggccaaagggatcagactgtaaatctgacgtcatagacttcgaa
ggttcgaatccttccccctcca

DBGET integrated database retrieval system