Alicyclobacillus dauci: NZD86_14360 Help Entry NZD86_14360       CDS       T08679                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism adau  Alicyclobacillus dauci Pathway adau00998   Biosynthesis of various antibiotics adau01100   Metabolic pathways adau01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:adau00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     NZD86_14360 (acpP)    00074 Mycolic acid biosynthesis     NZD86_14360 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     NZD86_14360 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 Guanylate_cyc DUF1493 Motif Other DBs NCBI-ProteinID:  WAH35474 UniProt:  A0ABY6YZG6 LinkDB All DBs Position complement(2825427..2825666) Genome browser AA seq 79 aa AA seqDB search MANDVFDRVKKIIVDRLSVDEDKVTMEATFKDDLGADSLDIVELIMELEDEFDLEISDED AEKIATVGDVVTYISNHQG NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggcaaacgacgtatttgatcgcgtgaagaaaattattgtcgacagactcagcgtcgat gaagataaggtaacgatggaagccacctttaaggatgatcttggggcggattccttggat atcgtcgagctgattatggaattagaagatgaattcgacttggaaatctctgatgaagat gctgagaaaatcgccacagtcggtgatgtagttacatacatcagcaatcaccagggctaa

DBGET integrated database retrieval system