Alicycliphilus denitrificans BC: Alide_3315 Help Entry Alide_3315        CDS       T01397                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism adn  Alicycliphilus denitrificans BC Brite KEGG Orthology (KO) [BR:adn00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:adn03036]     Alide_3315 Chromosome and associated proteins [BR:adn03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Alide_3315 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Crescentin ATG16 DUF4164 DivIVA TPR_MLP1_2 Rootletin GAS Taxilin CENPH CENP-F_leu_zip Cep57_CLD_2 Csm1_N LPP Nup54 SlyX DUF2205 bZIP_2 DUF7365 Xre_MbcA_ParS-like_N DivIC HalX Motif Other DBs NCBI-ProteinID:  ADV01035 LinkDB All DBs Position 3460696..3460935 Genome browser AA seq 79 aa AA seqDB search MDHPSSLDQIAERVERLLLRHAELQRTNALLAQQVSALTQERDSLKSRLQAARARVDALL DRLPATSAPAAPTETKDAP NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggaccacccctcctccctcgaccagatcgccgagcgtgtcgaacggctgctgctgcgc cacgcggagctgcaacgcaccaacgcactgctggcgcagcaggtctcggcgctcacgcag gagcgcgactccctgaagtcccgtctgcaggcggccagggcgcgcgtggatgcgctgctc gaccgcctgccggccacatccgcccccgccgcccccaccgagacgaaggacgcgccatga

DBGET integrated database retrieval system