Achromobacter deleyi: HLG70_07370 Help Entry HLG70_07370       CDS       T07788                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ady  Achromobacter deleyi Pathway ady01100   Metabolic pathways ady01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ady00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     HLG70_07370   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     HLG70_07370 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF4703 Motif Other DBs NCBI-ProteinID:  QVQ28233 LinkDB All DBs Position complement(1623956..1624207) Genome browser AA seq 83 aa AA seqDB search MTDAEILSALTDIFRDIFDDDTVEVNLESSAADFDAWDSLSNVNIMVATEMRFGVRFKTS EVEGLRNVGELLALIRKQLSARA NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgaccgatgcagaaatcctcagcgccttgacggatattttccgcgacatctttgatgat gacacggtggaagtcaacctggaatcgagcgcggccgacttcgacgcctgggactctctg agcaacgtgaacatcatggtcgccaccgaaatgcgctttggcgtgcgcttcaagacgtcc gaagtggaaggactgcgcaacgtgggcgagctcctcgctctcatacgcaagcaactctcc gcccgggcctga

DBGET integrated database retrieval system