Acidithiobacillus ferrivorans: Acife_2812 Help Entry Acife_2812        CDS       T01595                                  Name (GenBank) cell division protein FtsL   KO K03586   cell division protein FtsL Organism afi  Acidithiobacillus ferrivorans Brite KEGG Orthology (KO) [BR:afi00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:afi03036]     Acife_2812 Chromosome and associated proteins [BR:afi03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Acife_2812 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  FtsL DivIC Motif Other DBs NCBI-ProteinID:  AEM48887 UniProt:  G0JSH9 LinkDB All DBs Position 2780882..2781145 Genome browser AA seq 87 aa AA seqDB search MRRSTIIFALLITATLFGIVAARENTRSQFIALQEAQARHFALDNRWGQLQLEQATLASN ARVGDIARQKLGLAAPKNDQIVMVKAP NT seq 264 nt NT seq  +upstreamnt  +downstreamnt atgcggcgtagcaccattattttcgccctgctgattaccgctactctattcggaatcgtc gcggcaagagaaaatacccgtagccagttcatcgccttacaggaagcccaggccaggcat ttcgccctggacaaccgctggggccagctccaattggagcaggccacgcttgcttccaat gcccgcgtgggcgatattgcacgccaaaaactcgggcttgccgcccccaaaaatgatcaa attgtcatggtcaaagcaccatga

DBGET integrated database retrieval system