Ammonicoccus fulvus: AADG42_08560 Help Entry AADG42_08560      CDS       T10995                                  Symbol atpE Name (GenBank) ATP synthase F0 subunit C   KO K02110   F-type H+-transporting ATPase subunit c Organism afuv  Ammonicoccus fulvus Pathway afuv00190   Oxidative phosphorylation afuv01100   Metabolic pathways Module afuv_M00157   F-type ATPase, prokaryotes and chloroplasts Brite KEGG Orthology (KO) [BR:afuv00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     AADG42_08560 (atpE)  09180 Brite Hierarchies   09181 Protein families: metabolism    00194 Photosynthesis proteins [BR:afuv00194]     AADG42_08560 (atpE) Photosynthesis proteins [BR:afuv00194]  Photosystem and electron transport system   F-type ATPase [OT]    AADG42_08560 (atpE) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ATP-synt_C Motif Other DBs NCBI-ProteinID:  XAN07341 LinkDB All DBs Position 1807700..1807906 Genome browser AA seq 68 aa AA seqDB search MTGSLNMIGYGLATIGPGIGVALIFAAVINGTARQPEARGALMGTAWIGFAVVEALAIIG IALAFVLG NT seq 207 nt NT seq  +upstreamnt  +downstreamnt atgaccggttcgctcaacatgatcggctacggcctcgccaccatcggcccgggcatcggc gttgcgctgatcttcgccgctgtcatcaacggcaccgcccgtcagccggaggcccgtggc gcgctcatgggcaccgcctggatcggtttcgcggtggtcgaggcgctcgccattatcggt atcgccctcgcgttcgttctcggctga

DBGET integrated database retrieval system