Actinomyces israelii: AIF0345_1457 Help Entry AIF0345_1457      CDS       T06659                                  Symbol acpP Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism air  Actinomyces israelii Pathway air01100   Metabolic pathways air01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:air00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     AIF0345_1457 (acpP)    00074 Mycolic acid biosynthesis     AIF0345_1457 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     AIF0345_1457 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  WKR21541 LinkDB All DBs Position complement(1763712..1763960) Genome browser AA seq 82 aa AA seqDB search MAEETTDILTVIAEITAKEAGVEASAISRESRFAADLDIDSLGLLTIATEVEERFGVILD DSAIPTLPTVGALVDLVADQKG NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggccgaggagaccaccgatattctcaccgttatcgctgagatcaccgccaaggaggcg ggcgtcgaggcctccgcgatcagccgcgagtccagatttgccgccgacctcgacatcgac tccctcggcctgctcacgatcgcgaccgaggtcgaggagcgcttcggagtcatcctggac gactcggcgatacctacgcttccgacagtcggcgcactggttgacctcgtggccgaccag aagggctga

DBGET integrated database retrieval system