Alcaligenes sp. NLF5-7: MID00_15940 Help Entry MID00_15940       CDS       T10407                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism alcn  Alcaligenes sp. NLF5-7 Brite KEGG Orthology (KO) [BR:alcn00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:alcn03032]     MID00_15940    03036 Chromosome and associated proteins [BR:alcn03036]     MID00_15940    03400 DNA repair and recombination proteins [BR:alcn03400]     MID00_15940 DNA replication proteins [BR:alcn03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     MID00_15940 Chromosome and associated proteins [BR:alcn03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     MID00_15940 DNA repair and recombination proteins [BR:alcn03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       MID00_15940 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_1 HU-CCDC81_euk_2 MvaT_DBD Barstar Motif Other DBs NCBI-ProteinID:  UTM00974 LinkDB All DBs Position 3461837..3462109 Genome browser AA seq 90 aa AA seqDB search MNKTELIEFISTKADLSKADAGRALDAFIDAVTTTLKEKDTVTLVGFGTFAVSERAARSG RNPRTGETIEIEGANVPKFRPGKALKDAVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaataaaaccgagcttatcgaattcatttccaccaaagccgatctgtccaaagctgac gctggtcgtgcactggatgcgtttatcgatgccgtgaccaccacgctgaaagaaaaagat acggttactctggttggttttggcaccttcgctgtgtcggaacgcgctgcccgttcgggt cgtaacccacgtaccggtgaaaccatcgagatcgaaggcgcaaacgtgcccaagttccgt cccggtaaggctctgaaagacgctgtgaattaa

DBGET integrated database retrieval system