Agrobacterium larrymoorei: CFBP5473_23345 Help Entry CFBP5473_23345    CDS       T06268                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism alf  Agrobacterium larrymoorei Brite KEGG Orthology (KO) [BR:alf00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:alf03032]     CFBP5473_23345    03036 Chromosome and associated proteins [BR:alf03036]     CFBP5473_23345    03400 DNA repair and recombination proteins [BR:alf03400]     CFBP5473_23345 DNA replication proteins [BR:alf03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     CFBP5473_23345 Chromosome and associated proteins [BR:alf03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     CFBP5473_23345 DNA repair and recombination proteins [BR:alf03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       CFBP5473_23345 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG Glycos_trans_3N HU-DNA_bdg TASL Motif Other DBs NCBI-ProteinID:  QCJ00931 UniProt:  A0A4D7E6E6 LinkDB All DBs Position pTiCFBP5473:complement(86533..86811) Genome browser AA seq 92 aa AA seqDB search MTTTNEIADKIATEQNLTKAQAKTIVESVFKQITDAALAGAETSIPSFGKFKPKDTPERE GRNPATGATIKIAASKKLTFTPGKAVKDALNG NT seq 279 nt NT seq  +upstreamnt  +downstreamnt atgaccacaaccaatgaaatcgccgacaagatcgcaaccgaacagaacctgaccaaggcg caggccaagacgattgtcgagagcgtgttcaagcagatcacagacgcggcgcttgctggc gcagagacgtcgatcccctcgttcggaaagttcaagccgaaggacacgccggaacgtgaa ggccgtaacccggcaacaggcgcaacgatcaagatcgccgcttcgaaaaagctgacgttc acgcctggcaaggcggtcaaggacgcactgaacggctga

DBGET integrated database retrieval system