Agromyces marinus: DSM26151_25720 Help Entry DSM26151_25720    CDS       T08161                                  Name (GenBank) hypothetical protein   KO K18917   mycoredoxin [EC:1.20.4.3] Organism amau  Agromyces marinus Brite KEGG Orthology (KO) [BR:amau00001]  09190 Not Included in Pathway or Brite   09191 Unclassified: metabolism    99980 Enzymes with EC numbers     DSM26151_25720 Enzymes [BR:amau01000]  1. Oxidoreductases   1.20  Acting on phosphorus or arsenic in donors    1.20.4  With disulfide as acceptor     1.20.4.3  mycoredoxin      DSM26151_25720 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_3 GST_N_2 Thioredoxin_9 Thioredoxin Lipase_GDSL Motif Other DBs NCBI-ProteinID:  UIP59658 LinkDB All DBs Position 2757848..2758123 Genome browser AA seq 91 aa AA seqDB search MTTPATDLNPARITMYGAEWCGDCRRSKALLDRRGVDYEYVDLAVVADGADRAKAISGRT NIPVVVFPDGTHFTEPSDAELSAKLDEAAAA NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgacgacccccgcaaccgacctgaaccccgcccgcatcaccatgtacggcgccgagtgg tgcggcgactgccgccgctcgaaggcactgctcgaccgacgcggcgtggactacgagtac gtcgacctcgcggtcgtcgccgacggcgccgaccgcgcgaaggccatctcgggtcgcacg aacatccccgtcgtcgtcttccccgacggcacccacttcaccgagcccagcgacgccgag ctcagcgcgaagctcgacgaggccgcagcggcctga

DBGET integrated database retrieval system