Amycolatopsis mediterranei S699: AMES_3458 Help Entry AMES_3458         CDS       T02190                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism amm  Amycolatopsis mediterranei S699 Pathway amm00998   Biosynthesis of various antibiotics amm01100   Metabolic pathways amm01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:amm00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     AMES_3458 (acpP)    00074 Mycolic acid biosynthesis     AMES_3458 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     AMES_3458 (acpP) BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  PP-binding ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  AFO76994 UniProt:  A0A9R0U8V8 LinkDB All DBs Position 3795597..3795848 Genome browser AA seq 83 aa AA seqDB search MGVDSRVTVTEEITTLLHRNFGIEPEAVRIEASLHDLGMDSLALEELRVLLEERLDIDLE DVQLTSRETVGQLATAVDEKTAR NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgggagtcgacagcagagtgaccgtcaccgaagagatcaccacgcttctgcaccgcaac ttcggcatcgaaccggaggccgtgcggatcgaggcgtcgttgcacgacctggggatggat tcccttgccctggaggaattgcgcgtcctgctcgaggaacgcctggacatcgacctcgaa gacgtccagctgacctcgcgggagaccgtggggcagctggcgacggccgtcgacgagaag accgcccggtga

DBGET integrated database retrieval system