Amycolatopsis mediterranei S699: RAM_17785 Help Entry RAM_17785         CDS       T01822                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism amn  Amycolatopsis mediterranei S699 Pathway amn00998   Biosynthesis of various antibiotics amn01100   Metabolic pathways amn01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:amn00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     RAM_17785    00074 Mycolic acid biosynthesis     RAM_17785   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     RAM_17785 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  AEK42043 UniProt:  A0A9R0U8V8 LinkDB All DBs Position 3786494..3786745 Genome browser AA seq 83 aa AA seqDB search MGVDSRVTVTEEITTLLHRNFGIEPEAVRIEASLHDLGMDSLALEELRVLLEERLDIDLE DVQLTSRETVGQLATAVDEKTAR NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgggagtcgacagcagagtgaccgtcaccgaagagatcaccacgcttctgcaccgcaac ttcggcatcgaaccggaggccgtgcggatcgaggcgtcgttgcacgacctggggatggat tcccttgccctggaggaattgcgcgtcctgctcgaggaacgcctggacatcgacctcgaa gacgtccagctgacctcgcgggagaccgtggggcagctggcgacggccgtcgacgagaag accgcccggtga

DBGET integrated database retrieval system