Nostoc sp. PCC 7120: asl4827 Help Entry asl4827           CDS       T00069                                  Name (GenBank) GDP-D-mannose dehydratase   KO K01711   GDPmannose 4,6-dehydratase [EC:4.2.1.47] Organism ana  Nostoc sp. PCC 7120 Pathway ana00051   Fructose and mannose metabolism ana00541   Biosynthesis of various nucleotide sugars ana01100   Metabolic pathways ana01250   Biosynthesis of nucleotide sugars Brite KEGG Orthology (KO) [BR:ana00001]  09100 Metabolism   09101 Carbohydrate metabolism    00051 Fructose and mannose metabolism     asl4827   09107 Glycan biosynthesis and metabolism    00541 Biosynthesis of various nucleotide sugars     asl4827 Enzymes [BR:ana01000]  4. Lyases   4.2  Carbon-oxygen lyases    4.2.1  Hydro-lyases     4.2.1.47  GDP-mannose 4,6-dehydratase      asl4827 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-ProteinID:  BAB76526 UniProt:  Q8YMU9 LinkDB All DBs Position complement(5746424..5746537) Genome browser AA seq 37 aa AA seqDB search MVEADLQALGQTSPNGNTSILPQDIATIRQQLGVLHF NT seq 114 nt NT seq  +upstreamnt  +downstreamnt atggtagaagccgatttgcaagctttaggtcagacttctcccaatggtaatacttcaatc ctaccccaggatattgctactattcgtcaacaactgggtgtactccacttctga

DBGET integrated database retrieval system