Acetobacter persici: A0U91_16115 Help Entry A0U91_16115       CDS       T04751                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism aper  Acetobacter persici Pathway aper01100   Metabolic pathways aper01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:aper00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     A0U91_16115    00074 Mycolic acid biosynthesis     A0U91_16115   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     A0U91_16115 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding CLP_protease Motif Other DBs NCBI-ProteinID:  AQT06532 UniProt:  A0A1U9LJD1 LinkDB All DBs Position pAC1084_1:312936..313187 Genome browser AA seq 83 aa AA seqDB search MIDVARQVTRIIAEETSRKEEDISRESSLSNDLGMNSDALLDLGLSLEDHFGIEITLADA ARVLIALSTVQDVIDLIVQKTPR NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgattgatgtagcccgccaggttacgcgcattatcgccgaagaaacatcaagaaaagaa gaggatatttctcgggaatcatcgctttcaaatgatctcggcatgaacagcgatgcgctg ctcgatctgggattgtcactagaagatcattttggaatagaaattaccttagctgatgcg gcgcgcgtcctcattgctctgtcaaccgttcaggacgtcatcgacttgatagttcaaaaa acgcctcgctaa

DBGET integrated database retrieval system