Aquaspirillum sp. LM1: BXU06_02080 Help Entry BXU06_02080       CDS       T04696                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism aql  Aquaspirillum sp. LM1 Pathway aql01100   Metabolic pathways aql01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:aql00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     BXU06_02080    00074 Mycolic acid biosynthesis     BXU06_02080   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     BXU06_02080 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Ribosomal_L50 Ribosomal_L12_N Motif Other DBs NCBI-ProteinID:  AQR63980 UniProt:  A0A1U9JIT0 LinkDB All DBs Position 451520..451756 Genome browser AA seq 78 aa AA seqDB search MENIEARVKKIVAEQLGVNEAEVKNESSFVDDLGADSLDTVELVMALEEEFGCEIPDEDA EKITTVQQAIDYVTGHQE NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggaaaacatcgaagcacgtgtcaagaagatcgtggccgagcaactgggcgtgaacgaa gctgaagtgaagaacgaatcctccttcgtcgacgatctgggcgcggactcgctcgacacc gtcgaactggtgatggcgctggaagaagaattcggctgcgagattccggacgaagacgca gaaaagatcaccaccgttcagcaagccatcgactacgtgactggccatcaggaataa

DBGET integrated database retrieval system