Aquitalea sp. USM4: DKK66_12785 Help Entry DKK66_12785       CDS       T05865                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism aqs  Aquitalea sp. USM4 Pathway aqs01100   Metabolic pathways aqs01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:aqs00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     DKK66_12785    00074 Mycolic acid biosynthesis     DKK66_12785   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     DKK66_12785 SSDB OrthologParalogGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1896 Ribosomal_L50 DUF5783 DUF8312 Motif Other DBs NCBI-ProteinID:  QBJ78876 LinkDB All DBs Position 2761411..2761650 Genome browser AA seq 79 aa AA seqDB search MENIEARVKKIVAEQLGVNEAEVKIESSFVDDLGADSLDTVELVMALEEEFECEIPDEEA EKITTVQQAVDYVTAHLNK NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggaaaacatcgaagcgcgcgttaaaaagatcgttgccgaacaactgggcgtgaacgaa gctgaagtcaagatcgaatcgtccttcgttgatgatctgggcgctgactccctcgacacc gttgagctggtaatggctctggaagaagagttcgagtgcgaaatcccggacgaagaagct gaaaagatcaccactgttcagcaagccgttgattacgttaccgcccacctgaacaagtaa

DBGET integrated database retrieval system