Actinomyces respiraculi: ID810_05580 Help Entry ID810_05580       CDS       T07562                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism arep  Actinomyces respiraculi Pathway arep01100   Metabolic pathways arep01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:arep00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ID810_05580    00074 Mycolic acid biosynthesis     ID810_05580   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ID810_05580 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF8113 Motif Other DBs NCBI-ProteinID:  QPL06364 UniProt:  A0A7T0LM96 LinkDB All DBs Position complement(1337375..1337626) Genome browser AA seq 83 aa AA seqDB search MADETSTDVLAAVLEITAEEAGVDVSEVSETSRFADDLDIDSLGLLTIATQVEERFGVAL DDSLIPTLPTVGSLVELVTSQKG NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atggccgatgagaccagtaccgacgtcctcgccgccgtccttgaaatcaccgcggaggag gccggggtggacgtgagcgaggtgagcgagacctcccgcttcgccgacgacctcgacatc gactcgctgggcctgctcacgatcgccacccaggtggaggagcgtttcggcgtcgcgctg gacgactccctcatcccgacgctgccgacggtgggctccctcgtcgagctcgtgacctcc cagaagggctga

DBGET integrated database retrieval system