Azospira restricta: IWH25_00760 Help Entry IWH25_00760       CDS       T07061                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism ares  Azospira restricta Brite KEGG Orthology (KO) [BR:ares00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:ares03032]     IWH25_00760    03036 Chromosome and associated proteins [BR:ares03036]     IWH25_00760    03400 DNA repair and recombination proteins [BR:ares03400]     IWH25_00760 DNA replication proteins [BR:ares03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     IWH25_00760 Chromosome and associated proteins [BR:ares03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     IWH25_00760 DNA repair and recombination proteins [BR:ares03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       IWH25_00760 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 Motif Other DBs NCBI-ProteinID:  QRJ63925 UniProt:  A0A974SP91 LinkDB All DBs Position complement(172344..172628) Genome browser AA seq 94 aa AA seqDB search MNKSELIDAIAAGADISKAAAGRALDAAVAAITTAVSKGDNVTLVGFGSFKAAKRAARTG KNPKTGAAIKIPATTVPKFSAGASFKAAVAKKKK NT seq 285 nt NT seq  +upstreamnt  +downstreamnt atgaacaagagcgaactcatcgatgccatcgctgctggtgccgatatcagcaaggctgct gccggtcgcgccctcgacgccgccgttgccgccatcaccacggcagtttccaagggtgac aatgtgaccctggttggcttcggttccttcaaggccgccaagcgcgccgcccgcaccggc aagaacccgaagaccggcgccgccatcaagatcccggcgacgaccgtgccgaagttctcg gctggcgcgtccttcaaggccgctgtcgccaagaagaagaagtaa

DBGET integrated database retrieval system