Actinacidiphila reveromycinica: RVR_8891 Help Entry RVR_8891          CDS       T10579                                  Name (GenBank) putative acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism arev  Actinacidiphila reveromycinica Pathway arev00253   Tetracycline biosynthesis arev01056   Biosynthesis of type II polyketide backbone arev01100   Metabolic pathways arev01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:arev00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     RVR_8891    00253 Tetracycline biosynthesis     RVR_8891  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:arev01004]     RVR_8891    01008 Polyketide biosynthesis proteins [BR:arev01008]     RVR_8891 Lipid biosynthesis proteins [BR:arev01004]  Polyketide synthase   Component type    RVR_8891 Polyketide biosynthesis proteins [BR:arev01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      RVR_8891     Nonaketide PKS      RVR_8891     Decaketide PKS      RVR_8891 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  BBB01461 UniProt:  A0A7U3UWD2 LinkDB All DBs Position complement(7484846..7485121) Genome browser AA seq 91 aa AA seqDB search MTHIPFRLDDLRRILREGAGADETVDLEGEILDTDFGALGYESLALLETGSRIEREYGIA LGDDALAPDTTPRALIEAVNGELAPAPQPQS NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgacgcacatcccgttccgcctcgacgacctgcgccgcatcctgcgcgagggcgcgggc gcagacgagaccgtcgacctcgagggcgagatcctcgacaccgacttcggcgcgctcggc tacgagtcgctggccctgctggagaccggcagcaggatcgagcgcgagtacggcatcgcg ctcggcgacgacgcgctggcccccgacaccacgccccgggcgctgatcgaggcggtcaac ggcgagctggccccggctccgcaaccgcagtcgtag

DBGET integrated database retrieval system