Arthrobacter sp. Rue61a: ARUE_c25920 Help Entry ARUE_c25920       CDS       T02215                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism arr  Arthrobacter sp. Rue61a Pathway arr01100   Metabolic pathways arr01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:arr00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ARUE_c25920 (acpP)    00074 Mycolic acid biosynthesis     ARUE_c25920 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ARUE_c25920 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Ribosomal_L50 Ag332 Motif Other DBs NCBI-ProteinID:  AFR29486 LinkDB All DBs Position 2854345..2854590 Genome browser AA seq 81 aa AA seqDB search MASNEEILAGLAEIVNEETGLATEAVELDKSFTEDLDIDSISMMTIVVNAEEKFGVRIPD EEVKNLKTVGDAVSFIANAQA NT seq 246 nt NT seq  +upstreamnt  +downstreamnt atggctagcaacgaagagatcctggccggcctggctgaaatcgtcaacgaagaaaccggc ctcgccaccgaagccgtggagctggacaagtccttcaccgaggacctggacatcgactcc atctcgatgatgaccatcgtcgtcaacgccgaagagaagttcggcgttcgcatcccggac gaagaggtcaagaacctcaagaccgtcggcgacgccgtcagcttcatcgctaacgcacag gcctag

DBGET integrated database retrieval system