Agrobacterium rubi: G6M88_24930 Help Entry G6M88_24930       CDS       T08058                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism arui  Agrobacterium rubi Brite KEGG Orthology (KO) [BR:arui00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:arui03032]     G6M88_24930    03036 Chromosome and associated proteins [BR:arui03036]     G6M88_24930    03400 DNA repair and recombination proteins [BR:arui03400]     G6M88_24930 DNA replication proteins [BR:arui03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     G6M88_24930 Chromosome and associated proteins [BR:arui03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     G6M88_24930 DNA repair and recombination proteins [BR:arui03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       G6M88_24930 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG Glycos_trans_3N HU-DNA_bdg Motif Other DBs NCBI-ProteinID:  QTG03701 UniProt:  A0AAE7UTR7 LinkDB All DBs Position pTiW2_73:complement(47248..47526) Genome browser AA seq 92 aa AA seqDB search MTTTNEIADKIAAEQSLTKAQAKTIVESVFKQITDAALAGAETSIPSFGKFKLKDTPERE GRNPATGATIKIAASKKLTFTPGKAVKDALNG NT seq 279 nt NT seq  +upstreamnt  +downstreamnt atgaccacgaccaacgaaatcgccgacaagatcgcagccgaacagagcctgaccaaggcg caggccaagacgatcgtcgagagcgtcttcaagcagatcaccgacgcggcgcttgctggc gcggaaacgtcgatcccctcgttcggaaagttcaagctgaaggacacgccggaacgtgaa ggccgtaacccggcaacaggcgcaacgatcaagatcgccgcttcgaaaaagctgacgttc acgcctggcaaggcggtcaaggacgcactcaacggctga

DBGET integrated database retrieval system