Aeromonas schubertii: WL1483_3421 Help Entry WL1483_3421       CDS       T04186                                  Symbol cydX Name (GenBank) Cyd operon protein YbgT   KO K00424   cytochrome bd-I ubiquinol oxidase subunit X [EC:7.1.1.7] Organism asr  Aeromonas schubertii Pathway asr00190   Oxidative phosphorylation asr01100   Metabolic pathways asr02020   Two-component system Module asr_M00153   Cytochrome bd ubiquinol oxidase Brite KEGG Orthology (KO) [BR:asr00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     WL1483_3421 (cydX)  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     WL1483_3421 (cydX) Enzymes [BR:asr01000]  7. Translocases   7.1  Catalysing the translocation of protons    7.1.1  Linked to oxidoreductase reactions     7.1.1.7  quinol oxidase (electrogenic, proton-motive force generating)      WL1483_3421 (cydX) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  YbgT_YccB Motif Other DBs NCBI-ProteinID:  ALP42840 UniProt:  A0A0S2SMA9 LinkDB All DBs Position complement(3313804..3313914) Genome browser AA seq 36 aa AA seqDB search MWYFTWILGLLLACAFGIINALWLEHTENMDRTIDE NT seq 111 nt NT seq  +upstreamnt  +downstreamnt atgtggtatttcacctggatcctgggtctcctgctggcgtgtgcctttggcatcatcaac gccctctggctggagcataccgagaacatggatcgcacgatcgatgagtaa

DBGET integrated database retrieval system