Acidithiobacillus sulfuriphilus: EC580_011215
Help
Entry
EC580_011215 CDS
T11327
Name
(GenBank) hypothetical protein
Organism
asuu Acidithiobacillus sulfuriphilus
SSDB
Ortholog
Paralog
Gene cluster
GFIT
Other DBs
NCBI-ProteinID:
XRI76513
LinkDB
All DBs
Position
complement(2273390..2273734)
Genome browser
AA seq
114 aa
AA seq
DB search
MIHRGRFGILLFACLACLNGCASSPSGISSTTATSTAGGALLGGLAGAVIGNQTGSPLAG
AAIGAGIGGVAGAALAPPSPSAPYPPSCPPGYTCYPSTPVPACPAGYTCVPNAQ
NT seq
345 nt
NT seq
+upstream
nt +downstream
nt
atgatccatcggggaagattcggcatccttctgtttgcttgtctggcctgcctgaatggc
tgcgccagctctccctccggcatctcctcgactacggccaccagcactgccggcggcgcg
cttctcggtggactggcgggggcggtcatcggcaaccagacgggcagccccttggccggc
gcggccatcggcgccggtattggcggcgtggcgggagctgccctggcccctcctagcccg
agcgccccttatccaccctcgtgcccgcccggttacacctgttatcccagtacgcccgtg
cctgcctgtccggctggttacacctgcgtccccaatgcccagtga
DBGET
integrated database retrieval system