Aneurinibacillus thermoaerophilus: K3F53_11795 Help Entry K3F53_11795       CDS       T07487                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism athe  Aneurinibacillus thermoaerophilus Pathway athe00998   Biosynthesis of various antibiotics athe01100   Metabolic pathways athe01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:athe00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     K3F53_11795    00074 Mycolic acid biosynthesis     K3F53_11795   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     K3F53_11795 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  QYY41617 UniProt:  A0A1G7WCR7 LinkDB All DBs Position complement(2257231..2257464) Genome browser AA seq 77 aa AA seqDB search MADTFERVKKIIVDRLGVDESEVKEDASFKDDLGADSLDVVELVMELEDEFDLEISDEDA EKITTVGDVIKYIESHK NT seq 234 nt NT seq  +upstreamnt  +downstreamnt gtggcagatacgtttgagcgtgtgaaaaagatcatcgtagaccgactcggtgttgatgaa tctgaagttaaagaagacgcttcattcaaagacgaccttggcgctgattctcttgatgtc gtcgaacttgtaatggagcttgaagatgaattcgaccttgaaatctccgatgaagatgca gaaaaaatcacaactgtgggggatgtaattaaatacatagagtcccacaagtag

DBGET integrated database retrieval system