Actinomarinicola tropica: GH723_10525 Help Entry GH723_10525       CDS       T06914                                  Name (GenBank) integration host factor   KO K03530   DNA-binding protein HU-beta Organism atq  Actinomarinicola tropica Brite KEGG Orthology (KO) [BR:atq00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:atq03032]     GH723_10525    03036 Chromosome and associated proteins [BR:atq03036]     GH723_10525    03400 DNA repair and recombination proteins [BR:atq03400]     GH723_10525 DNA replication proteins [BR:atq03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     GH723_10525 Chromosome and associated proteins [BR:atq03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     GH723_10525 DNA repair and recombination proteins [BR:atq03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       GH723_10525 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding DUF2267 HU-CCDC81_euk_2 HU-HIG CUE Motif Other DBs NCBI-ProteinID:  QGG95495 UniProt:  A0A5Q2RQM1 LinkDB All DBs Position complement(2154338..2154613) Genome browser AA seq 91 aa AA seqDB search MNKSELVAAVAARTEQSQKDVDETINALFEVVAEAIGKGEKVSIPGWISFEQTERSARSG RNPATGETIQIPATKAAKVSAGSKLKAAAKG NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgaacaagtccgagctggtcgccgccgtcgccgcccgcaccgagcagagccagaaggac gtcgacgagacgatcaacgcgctcttcgaggtcgtggccgaggccatcgggaagggggag aaggtgagcatccccggctggatctcgttcgagcagacggagcgctccgcccgctccggc cgcaacccggccaccggtgagacgatccagatccctgccaccaaggccgccaaggtctcg gcgggttcgaagctcaaggctgccgccaagggctga

DBGET integrated database retrieval system