Pseudazoarcus pumilus: C0099_11570 Help Entry C0099_11570       CDS       T05265                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism atw  Pseudazoarcus pumilus Pathway atw01100   Metabolic pathways atw01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:atw00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     C0099_11570   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     C0099_11570 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF3046 PP-binding_2 NdhM Motif Other DBs NCBI-ProteinID:  AUN95509 UniProt:  A0A2I6S8B7 LinkDB All DBs Position 2361372..2361632 Genome browser AA seq 86 aa AA seqDB search MTQDFNNRFDALVHDHFGAQLADSGLDTVLADLELDSLGLLDFVMSLEQGFDVEIDVEVV NEDMTLMRIREVLRDLAGDRSAAAGS NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atgacgcaggacttcaacaaccgcttcgatgccctcgtccacgatcacttcggtgcgcaa ctggccgattcgggcctggatacggtgctcgccgacctggaactcgattcgctcgggttg ctggatttcgtgatgagtctggagcagggcttcgacgtcgaaatcgatgtcgaagtggtc aacgaggacatgacgctgatgcggatccgcgaggtgctgcgcgatctggccggcgaccgc tccgcggccgccggcagctga

DBGET integrated database retrieval system