Aerococcus urinaeequi: APT62_03230 Help Entry APT62_03230       CDS       T04249                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism aui  Aerococcus urinaeequi Pathway aui01100   Metabolic pathways aui01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:aui00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     APT62_03230    00074 Mycolic acid biosynthesis     APT62_03230   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     APT62_03230 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Ribosomal_L12_N DUF7080 Ribosomal_L50 HTH_33 Motif Other DBs NCBI-ProteinID:  ALZ87527 UniProt:  A0A0U4VWJ1 LinkDB All DBs Position 707440..707679 Genome browser AA seq 79 aa AA seqDB search MAESTTFEQVAALIVERFGVEASSVTPEMSFTDDLGADSLDVVELVMELEDNFGIQISDD DVEEIKTVADIVKYIDSHK NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggcagagagtacaacttttgaacaagtagcggctttaattgtggaacgtttcggtgtg gaggcttctagtgtgacgcctgagatgtcgtttacggacgatttgggtgcggattcgttg gacgttgtggaattggtgatggaattggaagataatttcggcatccagatttctgatgat gatgttgaagaaattaaaactgttgcggatattgtgaagtatatcgatagccataagtag

DBGET integrated database retrieval system