Alloalcanivorax xenomutans: P40_01350 Help Entry P40_01350         CDS       T04770                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism axe  Alloalcanivorax xenomutans Brite KEGG Orthology (KO) [BR:axe00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:axe03036]     P40_01350 Chromosome and associated proteins [BR:axe03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     P40_01350 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB NRBF2 EMP24_GP25L YabA DivIC Motif Other DBs NCBI-ProteinID:  ARB44223 UniProt:  A0A9Q3W3L8 LinkDB All DBs Position complement(287735..287950) Genome browser AA seq 71 aa AA seqDB search MTTEQQLRQLEAQVDSLLRQSNRLREENRLLREREHRLLDERARLIRKNDLARSRVEAII TRLQSLEQEDS NT seq 216 nt NT seq  +upstreamnt  +downstreamnt atgacgacggaacaacaactgcggcaactggaagcccaggtggactccctgctgcgtcag tccaaccgtttgcgcgaagagaatcgcctgctgcgtgagcgggaacaccgtcttctcgat gaacgggcccggctcatccgtaaaaacgacttggcccgctcccgggtggaggcgatcata acgcgcctgcaatccctggagcaggaggactcatga

DBGET integrated database retrieval system