Azoarcus sp. DN11: CDA09_10405 Help Entry CDA09_10405       CDS       T05691                                  Name (GenBank) phenol hydroxylase   KO K16249   phenol/toluene 2-monooxygenase (NADH) P0/A0 Organism azd  Azoarcus sp. DN11 Pathway azd00361   Chlorocyclohexane and chlorobenzene degradation azd00362   Benzoate degradation azd00623   Toluene degradation azd01100   Metabolic pathways azd01120   Microbial metabolism in diverse environments azd01220   Degradation of aromatic compounds Module azd_M00548   Benzene degradation, benzene => catechol Brite KEGG Orthology (KO) [BR:azd00001]  09100 Metabolism   09111 Xenobiotics biodegradation and metabolism    00362 Benzoate degradation     CDA09_10405    00361 Chlorocyclohexane and chlorobenzene degradation     CDA09_10405    00623 Toluene degradation     CDA09_10405 SSDB OrthologParalogGFIT Motif Pfam:  Phenol_hyd_sub Motif Other DBs NCBI-ProteinID:  AYH43795 LinkDB All DBs Position 2286783..2287049 Genome browser AA seq 88 aa AA seqDB search MSSHATPAGFDTRRRFVRVTGERANGFVEFDFAVGEPDLAVEMILTREAFAEFCERNAVE MLAPQAGPRDAADDWDWRLADATRTRFR NT seq 267 nt NT seq  +upstreamnt  +downstreamnt atgagcagccacgcgaccccggccggcttcgacacgcggcgccgcttcgtgcgtgtcact ggcgagcgtgccaacggtttcgtcgagttcgactttgcggtcggcgagccggacctggcg gtcgagatgatcctgacgcgcgaggccttcgcggagttctgcgagcgcaacgcggtcgag atgctcgcgccgcaggccggaccgcgcgacgccgcggacgactgggactggcgcctcgcc gacgcaacacgcacccgcttcaggtag

DBGET integrated database retrieval system