Azospirillum sp. TSA2s: E6C67_18565 Help Entry E6C67_18565       CDS       T10588                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism azp  Azospirillum sp. TSA2s Pathway azp01100   Metabolic pathways azp01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:azp00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     E6C67_18565    00074 Mycolic acid biosynthesis     E6C67_18565   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     E6C67_18565 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  QCG95870 LinkDB All DBs Position 3:complement(106460..106729) Genome browser AA seq 89 aa AA seqDB search MTPDDVRRVVLEELSNIAPEADLALLDPAADLREALDIDSMDHLNFVTALHNRLGVAIPE VDYPRLITLDGAVAYLMADPAIAAKAGIA NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgacgcccgacgatgtaagacgtgtggtgctggaggagctgagcaacatcgcccccgaa gccgaccttgccctcctcgaccctgcggccgaccttcgggaggcgctggacatcgactcc atggatcacctgaacttcgtgacggcgctgcacaaccggctgggcgtcgcgatccccgag gtcgattacccccgcctgatcaccctcgatggagcggtcgcctacctcatggccgatccg gcgattgcggcaaaagccgggatcgcatga

DBGET integrated database retrieval system